Remove uses of tuples from the test suite

src/test/bench/shootout-fasta.rs

@@ -21,24 +21,24 @@ obj myrandom(mutable u32 last) {
     }
 }
 
-type aminoacids = tup(char, u32);
+type aminoacids = rec(char ch, u32 prob);
 
 fn make_cumulative(vec[aminoacids] aa) -> vec[aminoacids] {
     let u32 cp = 0u32;
     let vec[aminoacids] ans = [];
-    for (aminoacids a in aa) { cp += a._1; ans += [tup(a._0, cp)]; }
+    for (aminoacids a in aa) { cp += a.prob; ans += [rec(ch=a.ch, prob=cp)]; }
     ret ans;
 }
 
 fn select_random(u32 r, vec[aminoacids] genelist) -> char {
-    if (r < genelist.(0)._1) { ret genelist.(0)._0; }
+    if (r < genelist.(0).prob) { ret genelist.(0).ch; }
     fn bisect(vec[aminoacids] v, uint lo, uint hi, u32 target) -> char {
         if (hi > lo + 1u) {
             let uint mid = lo + (hi - lo) / 2u;
-            if (target < v.(mid)._1) {
+            if (target < v.(mid).prob) {
                 be bisect(v, lo, mid, target);
             } else { be bisect(v, mid, hi, target); }
-        } else { ret v.(hi)._0; }
+        } else { ret v.(hi).ch; }
     }
     ret bisect(genelist, 0u, vec::len[aminoacids](genelist) - 1u, r);
 }
@@ -65,16 +65,18 @@ fn make_repeat_fasta(str id, str desc, str s, int n) {
     if (str::byte_len(op) > 0u) { log op; }
 }
 
+fn acid(char ch, u32 prob) { ret rec(ch=ch, prob=prob); }
+
 fn main(vec[str] args) {
     let vec[aminoacids] iub =
-        make_cumulative([tup('a', 27u32), tup('c', 12u32), tup('g', 12u32),
-                         tup('t', 27u32), tup('B', 2u32), tup('D', 2u32),
-                         tup('H', 2u32), tup('K', 2u32), tup('M', 2u32),
-                         tup('N', 2u32), tup('R', 2u32), tup('S', 2u32),
-                         tup('V', 2u32), tup('W', 2u32), tup('Y', 2u32)]);
+        make_cumulative([acid('a', 27u32), acid('c', 12u32), acid('g', 12u32),
+                         acid('t', 27u32), acid('B', 2u32), acid('D', 2u32),
+                         acid('H', 2u32), acid('K', 2u32), acid('M', 2u32),
+                         acid('N', 2u32), acid('R', 2u32), acid('S', 2u32),
+                         acid('V', 2u32), acid('W', 2u32), acid('Y', 2u32)]);
     let vec[aminoacids] homosapiens =
-        make_cumulative([tup('a', 30u32), tup('c', 20u32), tup('g', 20u32),
-                         tup('t', 30u32)]);
+        make_cumulative([acid('a', 30u32), acid('c', 20u32), acid('g', 20u32),
+                         acid('t', 30u32)]);
     let str alu =
         "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
             "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +

src/test/bench/task-perf-word-count.rs

@@ -134,9 +134,10 @@ mod map_reduce {
 
         map(input, bind emit(intermediates, ctrl, _, _));
 
-        for each(@tup(str, chan[reduce_proto]) kv in intermediates.items()) {
+        for each(@rec(str key, chan[reduce_proto] val) kv
+                 in intermediates.items()) {
             // log_err "sending done to reducer for " + kv._0;
-            kv._1 <| release;
+            kv.val <| release;
         }
 
         ctrl <| mapper_done;
@@ -228,9 +229,10 @@ mod map_reduce {
             }
         }
 
-        for each(@tup(str, chan[reduce_proto]) kv in reducers.items()) {
+        for each(@rec(str key, chan[reduce_proto] val) kv
+                 in reducers.items()) {
             // log_err "sending done to reducer for " + kv._0;
-            kv._1 <| done;
+            kv.val <| done;
         }
 
         // log_err #fmt("joining %u tasks", ivec::len(tasks));

src/test/compile-fail/binop-add-tup-assign.rs

@@ -1,7 +1,7 @@
 // xfail-stage0
-// error-pattern:+ cannot be applied to type `tup(bool)`
+// error-pattern:+ cannot be applied to type `rec(bool x)`
 
 fn main() {
-  auto x = tup(true);
-  x += tup(false);
+  auto x = rec(x=true);
+  x += rec(x=false);
 }

src/test/compile-fail/binop-add-tup.rs

@@ -1,6 +1,6 @@
 // xfail-stage0
-// error-pattern:+ cannot be applied to type `tup(bool)`
+// error-pattern:+ cannot be applied to type `rec(bool x)`
 
 fn main() {
-  auto x = tup(true) + tup(false);
+  auto x = rec(x=true) + rec(x=false);
 }

src/test/compile-fail/for-loop-decl.rs

@@ -9,9 +9,10 @@ type var_info = rec(uint a, uint b);
 fn bitv_to_str(fn_info enclosing, bitv::t v) -> str {
   auto s = "";
 
-  // error is that the value type in the hash map is var_info, not a tuple
-  for each (@tup(uint, tup(uint, uint)) p in enclosing.vars.items()) {
-    if (bitv::get(v, p._1._0)) {
+  // error is that the value type in the hash map is var_info, not a box
+  for each (@rec(uint key, @uint val) p
+            in enclosing.vars.items()) {
+    if (bitv::get(v, *p.val)) {
       s += "foo";
     }
   }

src/test/compile-fail/item-name-overload.rs

@@ -4,7 +4,7 @@
 
 mod foo {
   fn bar[T](T f) -> int { ret 17; }
-  type bar[U, T] = tup(int, U, T);
+  type bar[U, T] = rec(int a, U b, T c);
 }
 
 fn main() {}

src/test/compile-fail/writing-to-immutable-tup.rs

@@ -1,5 +0,0 @@
-// error-pattern: assignment to immutable field
-fn main() {
-  let tup(int) t = tup(1);
-  t._0 = 5;
-}

src/test/run-pass/acyclic-unwind.rs

@@ -4,12 +4,11 @@
 // xfail-stage3
 // -*- rust -*-
 
-fn f(chan[int] c)
-{
-  type t = tup(int,int,int);
+fn f(chan[int] c) {
+  type t = rec(int _0, int _1, int _2);
 
   // Allocate a box.
-  let @t x = @tup(1,2,3);
+  let @t x = @rec(_0=1, _1=2, _2=3);
 
   // Signal parent that we've allocated a box.
   c <| 1;

src/test/run-pass/auto-instantiate.rs

@@ -2,6 +2,6 @@
 
 
 // -*- rust -*-
-fn f[T, U](&T x, &U y) -> tup(T, U) { ret tup(x, y); }
+fn f[T, U](&T x, &U y) -> rec(T a, U b) { ret rec(a=x, b=y); }
 
-fn main() { log f(tup(3, 4, 5), 4)._0._0; log f(5, 6)._0; }
+fn main() { log f(rec(x=3, y=4, z=5), 4).a.x; log f(5, 6).a; }

src/test/run-pass/autoderef-full-lval.rs

@@ -4,7 +4,7 @@
 // -*- rust -*-
 type clam = rec(@int x, @int y);
 
-type fish = tup(@int);
+type fish = rec(@int a);
 
 fn main() {
     let clam a = rec(x=@1, y=@2);
@@ -12,9 +12,9 @@ fn main() {
     let int z = a.x + b.y;
     log z;
     assert (z == 21);
-    let fish forty = tup(@40);
-    let fish two = tup(@2);
-    let int answer = forty._0 + two._0;
+    let fish forty = rec(a=@40);
+    let fish two = rec(a=@2);
+    let int answer = forty.a + two.a;
     log answer;
     assert (answer == 42);
 }

src/test/run-pass/binops.rs

@@ -54,7 +54,7 @@ fn test_char() {
 fn test_box() {
   assert @10 == 10;
   assert 0xFF & @0xF0 == 0xF0;
-  assert tup(1, 3) < @tup(1, 4);
+  assert rec(a=1, b=3) < @rec(a=1, b=4);
   assert @rec(a = 'x') != @rec(a = 'y');
 }
 

src/test/run-pass/box-in-tup.rs

@@ -1,3 +0,0 @@
-
-
-fn main() { let tup(mutable @int) i = tup(mutable @10); i._0 = @11; }

src/test/run-pass/box-unbox.rs

@@ -1,12 +1,12 @@
 
 
-type box[T] = tup(@T);
+type box[T] = rec(@T c);
 
-fn unbox[T](&box[T] b) -> T { ret *b._0; }
+fn unbox[T](&box[T] b) -> T { ret *b.c; }
 
 fn main() {
     let int foo = 17;
-    let box[int] bfoo = tup(@foo);
+    let box[int] bfoo = rec(c=@foo);
     log "see what's in our box";
     assert (unbox[int](bfoo) == foo);
 }

src/test/run-pass/expr-alt-generic.rs

@@ -15,12 +15,12 @@ fn test_bool() {
     test_generic[bool](true, eq);
 }
 
-fn test_tup() {
-    type t = tup(int, int);
+fn test_rec() {
+    type t = rec(int a, int b);
 
-    fn compare_tup(&t t1, &t t2) -> bool { ret t1 == t2; }
-    auto eq = bind compare_tup(_, _);
-    test_generic[t](tup(1, 2), eq);
+    fn compare_rec(&t t1, &t t2) -> bool { ret t1 == t2; }
+    auto eq = bind compare_rec(_, _);
+    test_generic[t](rec(a=1, b=2), eq);
 }
 
-fn main() { test_bool(); test_tup(); }
+fn main() { test_bool(); test_rec(); }

src/test/run-pass/expr-block-generic.rs

@@ -17,12 +17,12 @@ fn test_bool() {
     test_generic[bool](true, eq);
 }
 
-fn test_tup() {
-    type t = tup(int, int);
+fn test_rec() {
+    type t = rec(int a, int b);
 
-    fn compare_tup(&t t1, &t t2) -> bool { ret t1 == t2; }
-    auto eq = bind compare_tup(_, _);
-    test_generic[t](tup(1, 2), eq);
+    fn compare_rec(&t t1, &t t2) -> bool { ret t1 == t2; }
+    auto eq = bind compare_rec(_, _);
+    test_generic[t](rec(a=1, b=2), eq);
 }
 
-fn main() { test_bool(); test_tup(); }
+fn main() { test_bool(); test_rec(); }

src/test/run-pass/expr-block-slot.rs

@@ -5,8 +5,8 @@
 
 // Regression test for issue #377
 fn main() {
-    auto a = { auto b = tup(3); b };
-    assert (a._0 == 3);
+    auto a = { auto b = rec(a=3); b };
+    assert (a.a == 3);
     auto c = { auto d = rec(v=3); d };
     assert (c.v == 3);
 }

src/test/run-pass/expr-if-generic.rs

@@ -17,12 +17,12 @@ fn test_bool() {
     test_generic[bool](true, false, eq);
 }
 
-fn test_tup() {
-    type t = tup(int, int);
+fn test_rec() {
+    type t = rec(int a, int b);
 
-    fn compare_tup(&t t1, &t t2) -> bool { ret t1 == t2; }
-    auto eq = bind compare_tup(_, _);
-    test_generic[t](tup(1, 2), tup(2, 3), eq);
+    fn compare_rec(&t t1, &t t2) -> bool { ret t1 == t2; }
+    auto eq = bind compare_rec(_, _);
+    test_generic[t](rec(a=1, b=2), rec(a=2, b=3), eq);
 }
 
-fn main() { test_bool(); test_tup(); }
+fn main() { test_bool(); test_rec(); }

src/test/run-pass/foreach-box-drop.rs

@@ -1,9 +1,9 @@
 
 
 obj ob[K](K k) {
-    iter foo() -> @tup(K) { put @tup(k); }
+    iter foo() -> @rec(K a) { put @rec(a=k); }
 }
 
-fn x(&ob[str] o) { for each (@tup(str) i in o.foo()) { } }
+fn x(&ob[str] o) { for each (@rec(str a) i in o.foo()) { } }
 
 fn main() { auto o = ob[str]("hi" + "there"); x(o); }

src/test/run-pass/foreach-put-structured.rs

@@ -1,15 +1,15 @@
 
 
-iter pairs() -> tup(int, int) {
+iter pairs() -> rec(int _0, int _1) {
     let int i = 0;
     let int j = 0;
-    while (i < 10) { put tup(i, j); i += 1; j += i; }
+    while (i < 10) { put rec(_0=i, _1=j); i += 1; j += i; }
 }
 
 fn main() {
     let int i = 10;
     let int j = 0;
-    for each (tup(int, int) p in pairs()) {
+    for each (rec(int _0, int _1) p in pairs()) {
         log p._0;
         log p._1;
         assert (p._0 + 10 == i);

src/test/run-pass/generic-bind-2.rs

@@ -3,8 +3,8 @@
 fn id[T](&T t) -> T { ret t; }
 
 fn main() {
-    auto t = tup(1, 2, 3, 4, 5, 6, 7);
-    assert (t._5 == 6);
-    auto f0 = bind id[tup(int, int, int, int, int, int, int)](t);
-    assert (f0()._5 == 6);
+    auto t = rec(a=1, b=2, c=3, d=4, e=5, f=6, g=7);
+    assert (t.f == 6);
+    auto f0 = bind id(t);
+    assert (f0().f == 6);
 }

src/test/run-pass/generic-bind.rs

@@ -3,8 +3,9 @@
 fn id[T](&T t) -> T { ret t; }
 
 fn main() {
-    auto t = tup(1, 2, 3, 4, 5, 6, 7);
+    auto t = rec(_0=1, _1=2, _2=3, _3=4, _4=5, _5=6, _6=7);
     assert (t._5 == 6);
-    auto f1 = bind id[tup(int, int, int, int, int, int, int)](_);
+    auto f1 = bind id[rec(int _0, int _1, int _2, int _3, int _4,
+                          int _5, int _6)](_);
     assert (f1(t)._5 == 6);
 }

src/test/run-pass/generic-box.rs

@@ -1,8 +1,8 @@
 
 
-fn box[T](&tup(T, T, T) x) -> @tup(T, T, T) { ret @x; }
+fn box[T](&rec(T x, T y, T z) x) -> @rec(T x, T y, T z) { ret @x; }
 
 fn main() {
-    let @tup(int, int, int) x = box[int](tup(1, 2, 3));
-    assert (x._1 == 2);
+    let @rec(int x, int y, int z) x = box[int](rec(x=1, y=2, z=3));
+    assert (x.y == 2);
 }

src/test/run-pass/generic-derived-type.rs

@@ -2,17 +2,17 @@
 
 fn g[X](&X x) -> X { ret x; }
 
-fn f[T](&T t) -> tup(T, T) {
-    type pair = tup(T, T);
+fn f[T](&T t) -> rec(T a, T b) {
+    type pair = rec(T a, T b);
 
-    let pair x = tup(t, t);
+    let pair x = rec(a=t, b=t);
     ret g[pair](x);
 }
 
 fn main() {
     auto b = f[int](10);
-    log b._0;
-    log b._1;
-    assert (b._0 == 10);
-    assert (b._1 == 10);
+    log b.a;
+    log b.b;
+    assert (b.a == 10);
+    assert (b.b == 10);
 }

src/test/run-pass/generic-exterior-box.rs

@@ -1,17 +1,11 @@
 
 
-type tupbox[T] = tup(@T);
-
 type recbox[T] = rec(@T x);
 
-fn tuplift[T](&T t) -> tupbox[T] { ret tup(@t); }
-
 fn reclift[T](&T t) -> recbox[T] { ret rec(x=@t); }
 
 fn main() {
     let int foo = 17;
-    let tupbox[int] tbfoo = tuplift[int](foo);
     let recbox[int] rbfoo = reclift[int](foo);
-    assert (tbfoo._0 == foo);
     assert (rbfoo.x == foo);
 }

src/test/run-pass/generic-fn.rs

@@ -4,15 +4,15 @@
 // -*- rust -*-
 fn id[T](&T x) -> T { ret x; }
 
-type triple = tup(int, int, int);
+type triple = rec(int x, int y, int z);
 
 fn main() {
     auto x = 62;
     auto y = 63;
     auto a = 'a';
     auto b = 'b';
-    let triple p = tup(65, 66, 67);
-    let triple q = tup(68, 69, 70);
+    let triple p = rec(x=65, y=66, z=67);
+    let triple q = rec(x=68, y=69, z=70);
     y = id[int](x);
     log y;
     assert (x == y);
@@ -20,8 +20,8 @@ fn main() {
     log b;
     assert (a == b);
     q = id[triple](p);
-    x = p._2;
-    y = q._2;
+    x = p.z;
+    y = q.z;
     log y;
     assert (x == y);
 }

src/test/run-pass/generic-obj-with-derived-type.rs

@@ -5,14 +5,16 @@ obj handle[T](T data) {
 }
 
 fn main() {
-    type rgb = tup(u8, u8, u8);
+    type rgb = rec(u8 x, u8 y, u8 z);
 
-    let handle[rgb] h = handle[rgb](tup(1 as u8, 2 as u8, 3 as u8));
+    let handle[rgb] h = handle[rgb](rec(x=1 as u8,
+                                        y=2 as u8,
+                                        z=3 as u8));
     log "constructed object";
-    log h.get()._0;
-    log h.get()._1;
-    log h.get()._2;
-    assert (h.get()._0 == 1 as u8);
-    assert (h.get()._1 == 2 as u8);
-    assert (h.get()._2 == 3 as u8);
+    log h.get().x;
+    log h.get().y;
+    log h.get().z;
+    assert (h.get().x == 1 as u8);
+    assert (h.get().y == 2 as u8);
+    assert (h.get().z == 3 as u8);
 }

src/test/run-pass/generic-obj.rs

@@ -1,6 +1,6 @@
 
 
-obj buf[T](tup(T, T, T) data) {
+obj buf[T](rec(T _0, T _1, T _2) data) {
     fn get(int i) -> T {
         if (i == 0) {
             ret data._0;
@@ -11,7 +11,7 @@ obj buf[T](tup(T, T, T) data) {
 }
 
 fn main() {
-    let buf[int] b = buf[int](tup(1, 2, 3));
+    let buf[int] b = buf[int](rec(_0=1, _1=2, _2=3));
     log "constructed object";
     log b.get(0);
     log b.get(1);

src/test/run-pass/generic-tag-values.rs

@@ -7,13 +7,13 @@ tag noption[T] { some(T); }
 fn main() {
     let noption[int] nop = some[int](5);
     alt (nop) { case (some[int](?n)) { log n; assert (n == 5); } }
-    let noption[tup(int, int)] nop2 = some[tup(int, int)](tup(17, 42));
+    let noption[rec(int x, int y)] nop2 = some(rec(x=17, y=42));
     alt (nop2) {
-        case (some[tup(int, int)](?t)) {
-            log t._0;
-            log t._1;
-            assert (t._0 == 17);
-            assert (t._1 == 42);
+        case (some(?t)) {
+            log t.x;
+            log t.y;
+            assert (t.x == 17);
+            assert (t.y == 42);
         }
     }
 }

src/test/run-pass/generic-tup.rs

@@ -1,9 +0,0 @@
-
-
-fn get_third[T](&tup(T, T, T) t) -> T { ret t._2; }
-
-fn main() {
-    log get_third(tup(1, 2, 3));
-    assert (get_third(tup(1, 2, 3)) == 3);
-    assert (get_third(tup(5u8, 6u8, 7u8)) == 7u8);
-}

src/test/run-pass/generic-type-synonym.rs

@@ -1,6 +1,6 @@
 
 
-type foo[T] = tup(T);
+type foo[T] = rec(T a);
 
 type bar[T] = foo[T];
 

src/test/run-pass/generic-type.rs

@@ -1,9 +1,9 @@
 
 
-type pair[T] = tup(T, T);
+type pair[T] = rec(T x, T y);
 
 fn main() {
-    let pair[int] x = tup(10, 12);
-    assert (x._0 == 10);
-    assert (x._1 == 12);
+    let pair[int] x = rec(x=10, y=12);
+    assert (x.x == 10);
+    assert (x.y == 12);
 }

src/test/run-pass/mlist-cycle.rs

@@ -7,14 +7,14 @@
 // -*- rust -*-
 use std;
 
-type cell = tup(mutable @list);
+type cell = rec(mutable @list c);
 
 tag list { link(@cell); nil; }
 
 fn main() {
-    let @cell first = @tup(mutable @nil());
-    let @cell second = @tup(mutable @link(first));
+    let @cell first = @rec(mutable c=@nil());
+    let @cell second = @rec(mutable c=@link(first));
     first._0 = @link(second);
     std::sys.rustrt.gc();
-    let @cell third = @tup(mutable @nil());
+    let @cell third = @rec(mutable c=@nil());
 }

src/test/run-pass/move-1.rs

@@ -1,16 +1,16 @@
-fn test(bool x, @tup(int, int, int) foo) -> int {
+fn test(bool x, @rec(int x, int y, int z) foo) -> int {
     auto bar = foo;
-    let @tup(int,int,int) y;
+    let @rec(int x,int y, int z) y;
     if (x) {
         y <- bar;
     } else {
-        y = @tup(4,5,6);
+        y = @rec(x=4, y=5, z=6);
     }
-    ret y._1;
+    ret y.y;
 }
 
 fn main() {
-    auto x = @tup(1,2,3);
+    auto x = @rec(x=1, y=2, z=3);
     assert (test(true, x) == 2);
     assert (test(true, x) == 2);
     assert (test(true, x) == 2);

src/test/run-pass/move-2.rs

@@ -1,3 +1,7 @@
 
 
-fn main() { auto x = @tup(1, 2, 3); auto y <- x; assert (y._1 == 2); }
+fn main() {
+    auto x = @rec(x=1, y=2, z=3);
+    auto y <- x;
+    assert (y.y == 2);
+}

src/test/run-pass/move-3.rs

@@ -1,19 +1,19 @@
 use std;
 import std::uint;
 
-fn test(bool x, @tup(int, int, int) foo) -> int {
+fn test(bool x, @rec(int x, int y, int z) foo) -> int {
     auto bar = foo;
-    let @tup(int,int,int) y;
+    let @rec(int x, int y, int z) y;
     if (x) {
         y <- bar;
     } else {
-        y = @tup(4,5,6);
+        y = @rec(x=4, y=5, z=6);
     }
-    ret y._1;
+    ret y.y;
 }
 
 fn main() {
-    auto x = @tup(1,2,3);
+    auto x = @rec(x=1, y=2, z=3);
     for each (uint i in uint::range(0u, 10000u)) {
         assert (test(true, x) == 2);
     }

src/test/run-pass/move-4.rs

@@ -2,11 +2,15 @@
 use std;
 import std::uint;
 
-fn test(@tup(int, int, int) foo) -> @tup(int, int, int) {
+fn test(@rec(int a, int b, int c) foo) -> @rec(int a, int b, int c) {
     auto bar <- foo;
     auto baz <- bar;
     auto quux <- baz;
     ret quux;
 }
 
-fn main() { auto x = @tup(1, 2, 3); auto y = test(x); assert (y._2 == 3); }
+fn main() {
+    auto x = @rec(a=1, b=2, c=3);
+    auto y = test(x);
+    assert (y.c == 3);
+}

src/test/run-pass/mutable-vec-drop.rs

@@ -1,8 +1,6 @@
 
-
 fn main() {
     // This just tests whether the vec leaks its members.
-
-    let vec[mutable @tup(int, int)] pvec =
-        [mutable @tup(1, 2), @tup(3, 4), @tup(5, 6)];
+    let vec[mutable @rec(int a, int b)] pvec =
+        [mutable @rec(a=1, b=2), @rec(a=3, b=4), @rec(a=5, b=6)];
 }

src/test/run-pass/output-slot-variants.rs

@@ -4,21 +4,21 @@ fn ret_int_i() -> int { ret 10; }
 
 fn ret_ext_i() -> @int { ret @10; }
 
-fn ret_int_tup() -> tup(int, int) { ret tup(10, 10); }
+fn ret_int_rec() -> rec(int a, int b) { ret rec(a=10, b=10); }
 
-fn ret_ext_tup() -> @tup(int, int) { ret @tup(10, 10); }
+fn ret_ext_rec() -> @rec(int a, int b) { ret @rec(a=10, b=10); }
 
-fn ret_ext_mem() -> tup(@int, @int) { ret tup(@10, @10); }
+fn ret_ext_mem() -> rec(@int a, @int b) { ret rec(a=@10, b=@10); }
 
-fn ret_ext_ext_mem() -> @tup(@int, @int) { ret @tup(@10, @10); }
+fn ret_ext_ext_mem() -> @rec(@int a, @int b) { ret @rec(a=@10, b=@10); }
 
 fn main() {
     let int int_i;
     let @int ext_i;
-    let tup(int, int) int_tup;
-    let @tup(int, int) ext_tup;
-    let tup(@int, @int) ext_mem;
-    let @tup(@int, @int) ext_ext_mem;
+    let rec(int a, int b) int_rec;
+    let @rec(int a, int b) ext_rec;
+    let rec(@int a, @int b) ext_mem;
+    let @rec(@int a, @int b) ext_ext_mem;
     int_i = ret_int_i(); // initializing
 
     int_i = ret_int_i(); // non-initializing
@@ -31,17 +31,17 @@ fn main() {
 
     ext_i = ret_ext_i(); // non-initializing
 
-    int_tup = ret_int_tup(); // initializing
+    int_rec = ret_int_rec(); // initializing
 
-    int_tup = ret_int_tup(); // non-initializing
+    int_rec = ret_int_rec(); // non-initializing
 
-    int_tup = ret_int_tup(); // non-initializing
+    int_rec = ret_int_rec(); // non-initializing
 
-    ext_tup = ret_ext_tup(); // initializing
+    ext_rec = ret_ext_rec(); // initializing
 
-    ext_tup = ret_ext_tup(); // non-initializing
+    ext_rec = ret_ext_rec(); // non-initializing
 
-    ext_tup = ret_ext_tup(); // non-initializing
+    ext_rec = ret_ext_rec(); // non-initializing
 
     ext_mem = ret_ext_mem(); // initializing
 

src/test/run-pass/rec-tup.rs

@@ -1,27 +0,0 @@
-
-
-
-// -*- rust -*-
-type point = rec(int x, int y);
-
-type rect = tup(point, point);
-
-fn f(rect r, int x1, int y1, int x2, int y2) {
-    assert (r._0.x == x1);
-    assert (r._0.y == y1);
-    assert (r._1.x == x2);
-    assert (r._1.y == y2);
-}
-
-fn main() {
-    let rect r = tup(rec(x=10, y=20), rec(x=11, y=22));
-    assert (r._0.x == 10);
-    assert (r._0.y == 20);
-    assert (r._1.x == 11);
-    assert (r._1.y == 22);
-    let rect r2 = r;
-    let int x = r2._0.x;
-    assert (x == 10);
-    f(r, 10, 20, 11, 22);
-    f(r2, 10, 20, 11, 22);
-}

src/test/run-pass/simple-qsort.rs

@@ -14,7 +14,7 @@ fn test_qsort() {
     sort::ivector::quick_sort(lteq, names);
 
     auto pairs = ivec::zip(expected, ivec::from_mut(names));
-    for (tup(int, int) p in pairs) {
+    for (rec(int _0, int _1) p in pairs) {
         log_err #fmt("%d %d", p._0, p._1);
         assert p._0 == p._1;
     }

src/test/run-pass/structured-compare.rs

@@ -3,14 +3,14 @@
 tag foo { large; small; }
 
 fn main() {
-    auto a = tup(1, 2, 3);
-    auto b = tup(1, 2, 3);
+    auto a = rec(x=1, y=2, z=3);
+    auto b = rec(x=1, y=2, z=3);
     assert (a == b);
-    assert (a != tup(1, 2, 4));
-    assert (a < tup(1, 2, 4));
-    assert (a <= tup(1, 2, 4));
-    assert (tup(1, 2, 4) > a);
-    assert (tup(1, 2, 4) >= a);
+    assert (a != rec(x=1, y=2, z=4));
+    assert (a < rec(x=1, y=2, z=4));
+    assert (a <= rec(x=1, y=2, z=4));
+    assert (rec(x=1, y=2, z=4) > a);
+    assert (rec(x=1, y=2, z=4) >= a);
     auto x = large;
     auto y = small;
     assert (x != y);

src/test/run-pass/task-comm-16.rs

@@ -40,20 +40,6 @@ fn test_str() {
     assert (s1.(3) as u8 == 't' as u8);
 }
 
-fn test_tup() {
-    type t = tup(int, u8, char);
-
-    let port[t] po = port();
-    let chan[t] ch = chan(po);
-    let t t0 = tup(0, 1u8, '2');
-    ch <| t0;
-    let t t1;
-    po |> t1;
-    assert (t0._0 == 0);
-    assert (t0._1 == 1u8);
-    assert (t0._2 == '2');
-}
-
 fn test_tag() {
     tag t { tag1; tag2(int); tag3(int, u8, char); }
     let port[t] po = port();
@@ -90,7 +76,6 @@ fn main() {
     test_rec();
     test_vec();
     test_str();
-    test_tup();
     test_tag();
     test_chan();
 }

src/test/run-pass/tup.rs

@@ -1,18 +0,0 @@
-
-
-
-// -*- rust -*-
-type point = tup(int, int);
-
-fn f(point p, int x, int y) { assert (p._0 == x); assert (p._1 == y); }
-
-fn main() {
-    let point p = tup(10, 20);
-    assert (p._0 == 10);
-    assert (p._1 == 20);
-    let point p2 = p;
-    let int x = p2._0;
-    assert (x == 10);
-    f(p, 10, 20);
-    f(p2, 10, 20);
-}

src/test/run-pass/type-params-in-for-each.rs

@@ -5,7 +5,7 @@ iter range(uint lo, uint hi) -> uint {
     while (lo_ < hi) { put lo_; lo_ += 1u; }
 }
 
-fn create_index[T](vec[tup(T, uint)] index, fn(&T) -> uint  hash_fn) {
+fn create_index[T](vec[rec(T a, uint b)] index, fn(&T) -> uint  hash_fn) {
     for each (uint i in range(0u, 256u)) { let vec[T] bucket = []; }
 }
 

src/test/run-pass/type-sizes.rs

@@ -13,13 +13,14 @@ fn main() {
     assert (size_of[char]() == 4 as uint);
     assert (size_of[i8]() == 1 as uint);
     assert (size_of[i32]() == 4 as uint);
-    assert (size_of[tup(u8, i8)]() == 2 as uint);
-    assert (size_of[tup(u8, i8, u8)]() == 3 as uint);
+    assert (size_of[rec(u8 a, i8 b)]() == 2 as uint);
+    assert (size_of[rec(u8 a, i8 b, u8 c)]() == 3 as uint);
     // Alignment causes padding before the char and the u32.
 
-    assert (size_of[tup(u8, i8, tup(char, u8), u32)]() == 16 as uint);
+    assert (size_of[rec(u8 a, i8 b, rec(char u, u8 v) c, u32 d)]()
+            == 16 as uint);
     assert (size_of[int]() == size_of[uint]());
-    assert (size_of[tup(int, ())]() == size_of[int]());
-    assert (size_of[tup(int, (), ())]() == size_of[int]());
+    assert (size_of[rec(int a, () b)]() == size_of[int]());
+    assert (size_of[rec(int a, () b, () c)]() == size_of[int]());
     assert (size_of[int]() == size_of[rec(int x)]());
 }

src/test/run-pass/vec-drop.rs

@@ -3,5 +3,7 @@
 fn main() {
     // This just tests whether the vec leaks its members.
 
-    let vec[@tup(int, int)] pvec = [@tup(1, 2), @tup(3, 4), @tup(5, 6)];
+    let vec[@rec(int x, int y)] pvec = [@rec(x=1, y=2),
+                                        @rec(x=3, y=4),
+                                        @rec(x=5, y=6)];
 }

src/test/run-pass/vec-in-tup.rs

@@ -1,6 +0,0 @@
-
-
-fn main() {
-    let tup(mutable vec[int]) i = tup(mutable [1, 2, 3]);
-    i._0 = [4, 5, 6];
-}

src/test/stdtest/either.rs

@@ -78,11 +78,11 @@ fn test_partition() {
                  right(13),
                  left(14)];
   auto result = partition(input);
-  assert (result._0.(0) == 10);
-  assert (result._0.(1) == 12);
-  assert (result._0.(2) == 14);
-  assert (result._1.(0) == 11);
-  assert (result._1.(1) == 13);
+  assert (result.lefts.(0) == 10);
+  assert (result.lefts.(1) == 12);
+  assert (result.lefts.(2) == 14);
+  assert (result.rights.(0) == 11);
+  assert (result.rights.(1) == 13);
 }
 
 #[test]
@@ -90,8 +90,8 @@ fn test_partition_no_lefts() {
   let (t[int, int])[] input = ~[right(10),
                                 right(11)];
   auto result = partition(input);
-  assert (len(result._0) == 0u);
-  assert (len(result._1) == 2u);
+  assert (len(result.lefts) == 0u);
+  assert (len(result.rights) == 2u);
 }
 
 #[test]
@@ -99,14 +99,14 @@ fn test_partition_no_rights() {
   let (t[int, int])[] input = ~[left(10),
                                 left(11)];
   auto result = partition(input);
-  assert (len(result._0) == 2u);
-  assert (len(result._1) == 0u);
+  assert (len(result.lefts) == 2u);
+  assert (len(result.rights) == 0u);
 }
 
 #[test]
 fn test_partition_empty() {
   let (t[int, int])[] input = ~[];
   auto result = partition(input);
-  assert (len(result._0) == 0u);
-  assert (len(result._1) == 0u);
+  assert (len(result.lefts) == 0u);
+  assert (len(result.rights) == 0u);
 }

src/test/stdtest/ivec.rs

@@ -285,15 +285,15 @@ fn test_zip_unzip() {
     auto v2 = ~[4, 5, 6];
     auto z1 = ivec::zip(v1, v2);
 
-    assert tup(1, 4) == z1.(0);
-    assert tup(2, 5) == z1.(1);
-    assert tup(3, 6) == z1.(2);
+    assert rec(_0=1, _1=4) == z1.(0);
+    assert rec(_0=2, _1=5) == z1.(1);
+    assert rec(_0=3, _1=6) == z1.(2);
 
     auto u1 = ivec::unzip(z1);
 
-    assert tup(1, 4) == tup(u1._0.(0), u1._1.(0));
-    assert tup(2, 5) == tup(u1._0.(1), u1._1.(1));
-    assert tup(3, 6) == tup(u1._0.(2), u1._1.(2));
+    assert rec(_0=1, _1=4) == rec(_0=u1._0.(0), _1=u1._1.(0));
+    assert rec(_0=2, _1=5) == rec(_0=u1._0.(1), _1=u1._1.(1));
+    assert rec(_0=3, _1=6) == rec(_0=u1._0.(2), _1=u1._1.(2));
 }
 
 // Local Variables:

src/test/stdtest/qsort.rs

@@ -50,7 +50,7 @@ fn test_simple() {
     sort::ivector::quick_sort(lteq, names);
 
     auto pairs = ivec::zip(expected, ivec::from_mut(names));
-    for (tup(int, int) p in pairs) {
+    for (rec(int _0, int _1) p in pairs) {
         log #fmt("%d %d", p._0, p._1);
         assert p._0 == p._1;
     }

src/test/stdtest/test.rs

@@ -105,7 +105,7 @@ fn sort_tests() {
 
     auto pairs = ivec::zip(expected, filtered);
 
-    for (tup(str, test::test_desc) p in pairs) {
+    for (rec(str _0, test::test_desc _1) p in pairs) {
         assert p._0 == p._1.name;
     }
 }